(wt) 5'- ATGGTGCATCTGACTCCTGAGGAG (mut)5'- ATGGTGCATCTGACCCTGAGGAGA (USMLoid) Shown above are coding-strand sequences from the start of translation of the beta-globin gene. The upper sequence (wt) is normal, the lower, mut, sequence comes from a patient with beta-thalassemia. Which of the following is the most likely effect of the mutation? לפניך שני רצפים-מקודדים שנלקחו מאזור תחילת התרגום של הגן המקודד לחלבון – בטא גלובין. הרצף העליון ידוע כרצף הנורמלי (wt) ואילו הרצף התחתון נלקח מאדם החולה בבטא-תלסמיה. מה מהבאים תהיה ככל הנראה השפעתה של המוטציה?