Molecular Biology-מעבדה רפואית
- 193 שאלות
- 33 תגובות
- 0% הושלמו
- equalizer סטטיסטיקות
- share שתף
מנהלים:
Discuss, Learn and be Happy דיון בשאלות
help
brightness_4
brightness_7
format_textdirection_r_to_l
format_textdirection_l_to_r
(USMLoid) Which of the following is the major role of the 3'->5' exonuclease activity of DNA polymerases?
1
| done | ||
מיין לפי
The aberrant GA base-pair shown will most likely be fixed to give which of the following?
1
| done | ||
מיין לפי
Which repair mechanism is most likely to repair the DNA damage shown? איזה מהמנגנוני תיקון הבאים הוא הסביר ביותר לתקן את הנזק ב- DNA המוצג בתמונה?
1
| done | ||
מיין לפי
Which repair mechanism is most likely to repair the DNA damage shown? איזה מהמנגנוני תיקון הבאים הוא הסביר ביותר לתקן את הנזק ב- DNA המוצג בתמונה?
1
| done | ||
מיין לפי
Shown here are the regulatory regions of genes encoding Y and ΔY (top). You have cells which express the steroid hormone (X) receptor (Xrec) under the control of a constitutive promoter. Hormone-bound Xrec is a transcription activator binding to its recognition sequence XrecBS. The transcription factor Y contains a DNA-binding domain at the amino terminus that recognizes the sequence YBS and a c-terminus polyglutamine sequence. The transcription factor ΔY is the same as Y, but is missing the c-terminus polyglutamine sequence. The relative half-lives of X, Y, and ΔY are as follows t½X = 5, t½Y = 5, t½ΔY = 15. Which of the graphs best describes the rate of transcription from the Y promoter after the addition of hormone X at the time indicated?
1
| done | ||
מיין לפי
The four labelled DNA sequences are bound by proteins with sequence-specific DNA-binding domains. Which one most likely binds to a PolII general transcription factor? ארבעת רצפי ה-DNA המסומנים נקשרים ע"י חלבונים בעלי דומיין קישור לרצפי DNA ספציפיים. איזה מהם, ככל הנראה נקשר לפקטור שעתוק כללי של Pol-II?
1
| done | ||
מיין לפי
5 different variably sized fragments of DNA upstream (5') of Human Gene Y, between +1 and -1500, were fused to the 5' end of a fragment of DNA encoding the Luciferase enzyme. The start of transcription is at +1, the root of the bent arrow. A scale is shown at top left. These reporter constructs were then transfected into a human cell line. Cytosol extracts were prepared 24 hours later and luciferase activity measured. The results are shown to the right for each construct. Which of the following segments of the 5' upstream sequence is most likely to contain an enhancer element.
1
| done |
מיין לפי
You transfer wildtype E.coli from plates containing lactose to plates containing both glucose and lactose. Under these conditions indicate what sequence of events will occur at the lac operon promoter.
1
| done | ||
מיין לפי
The alanine aminoacyl tRNA synthetase enzyme of E. coli recognizes the alanine tRNA only by an unusual G:U base pair at position 70 in the stem of the tRNA. In the laboratory, you make a copy of the alanine tRNA gene that is identical to the wildtype copy except that the anicodon sequence 5' - IGC -3' is replaced with the sequence 5' - UCA -3'. You then add this mutant tRNA gene back into a wildtype E. coli. As a result,
1
| done | ||
מיין לפי
(wt) 5'- ATGGTGCATCTGACTCCTGAGGAG (mut)5'- ATGGTGCATCTGACCCTGAGGAGA (USMLoid) Shown above are coding-strand sequences from the start of translation of the beta-globin gene. The upper sequence (wt) is normal, the lower, mut, sequence comes from a patient with beta-thalassemia. Which of the following is the most likely effect of the mutation? לפניך שני רצפים-מקודדים שנלקחו מאזור תחילת התרגום של הגן המקודד לחלבון – בטא גלובין. הרצף העליון ידוע כרצף הנורמלי (wt) ואילו הרצף התחתון נלקח מאדם החולה בבטא-תלסמיה. מה מהבאים תהיה ככל הנראה השפעתה של המוטציה?
1
| done | ||
מיין לפי