שאלה | (wt) 5'- ATGGTGCATCTGACTCCTGAGGAG (mut) 5'- ATGGTGCATCTGACCCTGAGGAGA (USMLoid) Shown above are coding-strand sequences from the start of translation of the beta-globin gene. The upper sequence (wt) is normal, the lower, mut, sequence comes from a patient with beta-thalassemia. Which of the following is the most likely effect of the mutation? לפניך שני רצפים-מקודדים שנלקחו מאזור תחילת התרגום של הגן המקודד לחלבון – בטא גלובין. הרצף העליון ידוע כרצף הנורמלי (wt) ואילו הרצף התחתון נלקח מאדם החולה בבטא-תלסמיה. מה מהבאים תהיה ככל הנראה השפעתה של המוטציה?

(wt) 5'- ATGGTGCATCTGACTCCTGAGGAG (mut) 5'- ATGGTGCATCTGACCCTGAGGAGA (USMLoid) Shown above are coding-strand sequences from the start of translation of the beta-globin gene. The upper sequence (wt) is normal, the lower, mut, sequence comes from a patient with beta-thalassemia. Which of the following is the most likely effect of the mutation? לפניך שני רצפים-מקודדים שנלקחו מאזור תחילת התרגום של הגן המקודד לחלבון – בטא גלובין. הרצף העליון ידוע כרצף הנורמלי (wt) ואילו הרצף התחתון נלקח מאדם החולה בבטא-תלסמיה. מה מהבאים תהיה ככל הנראה השפעתה של המוטציה?

		Synthesis of a non-functional gene product. סינטזה של תוצר לא פונקציונלי
		Production of an unstable beta-globin protein ייצור של חלבון בטא-גלובין לא יציב
		No effect לא תהיה כל השפעה
		Increased beta-globin production עליה בייצור בטא-גלובין
		Incorrect splicing of the RNA product שחבור (ספלייסינג) שגוי של ה-RNA המשועתק

מיין לפי