שאלה | (wt) 5'- ATGGTGCATCTGACTCCTGAGGAG (mut)5'- ATGGTGCATCTGACCCTGAGGAGA (USMLoid) Shown above are coding-strand sequences from the start of translation of the beta-globin gene. The upper sequence (wt) is normal, the lower, mut, sequence comes from a patient with beta-thalassemia. Which of the following is the most likely effect of the mutation?

(wt) 5'- ATGGTGCATCTGACTCCTGAGGAG (mut)5'- ATGGTGCATCTGACCCTGAGGAGA (USMLoid) Shown above are coding-strand sequences from the start of translation of the beta-globin gene. The upper sequence (wt) is normal, the lower, mut, sequence comes from a patient with beta-thalassemia. Which of the following is the most likely effect of the mutation?

		1. Increased beta-globin production
		2. Incorrect splicing of the RNA product
		3. Production of an unstable beta-globin protein
		4. Synthesis of a non-functional gene product.
		5. No effect

מיין לפי