Molecular Biology-מעבדה רפואית

(USMLoid) Which of the following is the major role of the 3'->5' exonuclease activity of DNA polymerases?

1

שאלה #39162

		Excision of thymidine dimers
		Removing mismatched nucleotides
		Removal of RNA primer sequences in the lagging strand
		cleaving Okazaki fragments
		Elongation of DNA strands

מיין לפי

Which of the following mechanisms can be used to fix a double stranded DNA break

1

שאלה #39163

		Mismatch repair
		Homologous Recombination
		Non-homologous End Joining
		Base Excision Repair
		Nucleotide Excision Repair

מיין לפי

(USMLoid) Ultraviolet irradiation of cells can produce dimers between which of the following bases in DNA?

1

שאלה #39164

		A and T
		G and G
		A and G
		T and T
		G and C

מיין לפי

CCATACACACCCC GTGGTGAGAGGAC AACTTGTCTACAG GTTATAACAGTCT CGTTCGGCACAGG TCATTGACCTTTT ACCTTGACACAGA TAGTCGATACGCA ATATTGGCAAGGA These are nine sequences from the -35 regions of 9 typical prokaryotic promoters. Which one is most likely to contain the -35 concensus sequence?

1

שאלה #39165

		GTGGTGAGAGGAC
		ACCTTGACACAGA
		AACTTGTCTACAG
		CCATACACACCCC
		GTTATAACAGTCT
		ATATTGGCAAGGA
		TAGTCGATACGCA
		TCATTGACCTTTT

מיין לפי

Ran Unikel 0 נקודות · יותר מ-6 חודשים

מוניטין: 45

טיטי גאקא

(USMLoid) The fragment of DNA shown is transcribed. Which of the following is most likely to be a product of that transcription?

1

שאלה #39166

		5‘-CGUGGGCCUUAGGGCACCUUGG-3’
		5‘-GGTTCCACGGGATTCCGGGAGC-3’
		5‘-CCAAGGUGCCCUAAGGCCCUCG-3’
		5‘-GCUCCCGGAAUCCCGUGGAACC-3’
		5‘-GCTCCCGGAATCCCGTGGAACC-3’

מיין לפי

Match the features labeled in the diagram with the names in the following list. התאם בין הסימונים באיור לשמות מן הרשימה הבאה: i. 5' end of DNA ii. 3' end of DNA iii. 3' end of RNA iv. coding strand v. sense strand vi. template strand vii. 5' end of gene viii. 3' end of gene ix. 5' end of RNA

1

שאלה #39167

		A - vii, B - ii, C - ix, D - vi, E - v.
		A - viii, B - ii, C - ix, D - v, E - vi.
		A - i, B - iv, C - iii, D - v, E - iv
		A - vii, B - iii, C - i, D - v, E - vi.
		A - ii, B - ix, C - ii, D - v, E - vi
		A - viii, B - iii, C - i, D - vi, E - v.

נערך לפני 3 שנים Rotem Grimberg

מיין לפי

Adi Krassin 4 נקודות · יותר מ-6 חודשים

מוניטין: 80

A - ii, B - ix, C - ii, D - v, E - vi לפי הקוויז גם זו תשובה נכונה

Maayan Shelef 1 נקודות · יותר מ-6 חודשים

מוניטין: 15

סתמי

Esti Gerbi 0 נקודות · יותר מ-6 חודשים

מוניטין: 1

מתה

Alina Jolkovsky 0 נקודות · יותר מ-6 חודשים

מוניטין: 1

אם את מתה.. מגיע לך מועד ג'?

Ran Unikel 0 נקודות · יותר מ-6 חודשים

מוניטין: 45

מדהים

(wt) 5'- ATGGTGCATCTGACTCCTGAGGAG (mut) 5'- ATGGTGCATCTGACCCTGAGGAGA (USMLoid) Shown above are coding-strand sequences from the start of translation of the beta-globin gene. The upper sequence (wt) is normal, the lower, mut, sequence comes from a patient with beta-thalassemia. Which of the following is the most likely effect of the mutation? לפניך שני רצפים-מקודדים שנלקחו מאזור תחילת התרגום של הגן המקודד לחלבון – בטא גלובין. הרצף העליון ידוע כרצף הנורמלי (wt) ואילו הרצף התחתון נלקח מאדם החולה בבטא-תלסמיה. מה מהבאים תהיה ככל הנראה השפעתה של המוטציה?

1

שאלה #39168

		Synthesis of a non-functional gene product. סינטזה של תוצר לא פונקציונלי
		Production of an unstable beta-globin protein ייצור של חלבון בטא-גלובין לא יציב
		No effect לא תהיה כל השפעה
		Increased beta-globin production עליה בייצור בטא-גלובין
		Incorrect splicing of the RNA product שחבור (ספלייסינג) שגוי של ה-RNA המשועתק

מיין לפי

(USMLoid) In mammalian genomic DNA, methylation of C at position 5 of the pyrimidine sometimes occurs in the dinucleotide CpG. These sequences are unusually susceptible to mutation. Which of the following is the reason? ב-DNA גנומי של יונקים, מתרחשת לעיתים מתילציה בעמדה מס' 5 של הפרימידין C, כאשר הוא מופיע בקונטקסט CpG. רצפים אלו רגישים באופן יוצא דופן ליצירת מוטציות. מי מהבאים היא הסיבה?

1

שאלה #39401

		5mC may be converted to T by deamination Cm5 עשוי להפוך ל-T בעקבות דה-אמינציה
		5mC reduces the strength of hydrogen bonding with its complement on the other DNA strand. Cm5 מוריד את חוזק קשרי המימן שלו עם הנוקלאוטיד המשלים לו בגדיל השני.
		Methylated DNA is more frequently subjected to homologous recombination. DNA שעבר מתילציה יעבור בתדירות גבוהה יותר רקומבינציה הומולוגית
		Methylated DNA is more exposed to exogenous mutagens DNA שעבר מתילציה חשוף יותר לחומרים מוטגנים שמקורם מחוץ לגוף
		5mC interferes with progression of the DNA replication fork Cm5 מפריע להתקדמות מזלג השכפול

מיין לפי

Which of the following DNA repair mechanisms is directly coupled to the transcription machinery.

1

שאלה #39402

		Nucleotide Excision Repair
		Mismatch Repair
		Base Excision Repair
		Nonhomologous End Joining

מיין לפי

Which of the following repair pathways is most likely to result in an imperfect repair? מי ממסלולי התיקון הבאים עשוי לגרום קרוב לוודאי לתיקון לא מושלם?

1

שאלה #39403

		Photolyase
		Mismatch repair
		Homologous Recombination
		Nucleotide Excision Repair
		Non-homologous End Joining

מיין לפי

Molecular Biology-מעבדה רפואית

Discuss, Learn and be Happy דיון בשאלות

(USMLoid) Which of the following is the major role of the 3'->5' exonuclease activity of DNA polymerases?

Which of the following mechanisms can be used to fix a double stranded DNA break

(USMLoid) Ultraviolet irradiation of cells can produce dimers between which of the following bases in DNA?

CCATACACACCCC GTGGTGAGAGGAC AACTTGTCTACAG GTTATAACAGTCT CGTTCGGCACAGG TCATTGACCTTTT ACCTTGACACAGA TAGTCGATACGCA ATATTGGCAAGGA These are nine sequences from the -35 regions of 9 typical prokaryotic promoters. Which one is most likely to contain the -35 concensus sequence?

(USMLoid) The fragment of DNA shown is transcribed. Which of the following is most likely to be a product of that transcription?

Which of the following DNA repair mechanisms is directly coupled to the transcription machinery.

Which of the following repair pathways is most likely to result in an imperfect repair? מי ממסלולי התיקון הבאים עשוי לגרום קרוב לוודאי לתיקון לא מושלם?

בקשה לשינוי התשובה / תיקון שאלה gavel

בקשה למחיקת השאלהmood_bad

בקשה לשינוי התשובה / תיקון שאלה

בקשה למחיקת השאלה