Molecular Biology Module 4: Translation

(wt) 5'- ATGGTGCATCTGACTCCTGAGGAG (mut)5'- ATGGTGCATCTGACCCTGAGGAGA (USMLoid) Shown above are coding-strand sequences from the start of translation of the beta-globin gene. The upper sequence (wt) is normal, the lower, mut, sequence comes from a patient with beta-thalassemia. Which of the following is the most likely effect of the mutation?

1

(USMLoid) Which of the following tripeptides would be represented in polypeptides produced following the addition of the sequence (5'-GGCU)50 to a cell-free translation system?

1

An anticodon of human tyrosinyl-tRNA is 5'-GUA-3'. Which of the following is most likely to be a tyrosine codon?

1

(USMLoid) Which of the following best describes the role of codons in eukaryotic cells?

1

(USMLoid) Which of the following is a result of the degeneracy of the genetic code?.

1

(USMLoid) Which of the following is responsible for determining the amino acid sequence of a protein being synthesized by a ribosome.

1

(USMLoid) The single tyrosine tRNA recognises both of the tyrosine codons - UAU and UAC. Which of the following is therefore the anticodon sequence of this tRNA?

1

שאלה #57553

		1. 5' - AAA - 3'
		2. 5' - GAG - 3'
		3. 5' - AAG - 3'
		4. 5' - UUA - 3'
		5. 5' - GUA - 3'

This is a question about the wobble position - and yes, it corresponds almost exactly to a USMLE question. However, you can answer it without remembering almost anything about that table of non-canonical base-pairings at the wobble position. Just think it through. All the choices except the correct one are eliminated even if you just remember that a base never base-pairs with itself. The correct answer is: 5' - GUA - 3'

נערך לפני 3 שנים Ido Cohen Lass

מיין לפי

The following piece of DNA codes for an mRNA. The top strand is the template strand. The initiation and termination codons are in the sequence. 5'-AATTACCATGAAATTGTCATCTACTTGTTGATTA-3' 3'-TTAATGGTACTTTAACAGTAGATGAACAACTAAT-5 The sequence of the protein encoded by this transcript is:

1

שאלה #57554

		1. COOH-Met-Lys-Leu-Ser-Ser-Thr-Cys-NH2
		2. NH2-Met-Lys-Leu-Ser-Ser-Thr-Cys-COOH
		3. COOH-Met-Thr-Ile-Ser-Trp-NH2
		4. NH2-Met-Thr-Ile-Ser-Trp-COOH
		5. None of these is correct

נערך לפני 3 שנים Ido Cohen Lass

מיין לפי

(USMLoid) You have identified a mutation in a gene transcribed in the liver. At codon 42 of the expected translation product you find 5'-CAT-3' instead of the normal codon 5'-GAT-3'. This same mutation is found associated with type II diabetes in a large kindred. Which of the following best describes the effect of this change on the protein encoded?

1

שאלה #57555

		1. Val ---> Leu
		2. His ---> Asp
		3. Asp ---> His
		4. Leu ---> Val
		5. Addition of amino acid sequence beyond the normal carboxy terminus

נערך לפני 3 שנים Ido Cohen Lass

מיין לפי

Acetylation of histones often results in:

1

שאלה #57559

		1. None of these is correct.
		2. decreased transport of RNA polymerase II into the nucleus
		3. decreased nucleosome density and decreased transcription
		4. increased transport of RNA polymerase II into the nucleus
		5. decreased nucleosome density and increased transcription
		6. proteolytic degradation of the histones

נערך לפני 3 שנים Ido Cohen Lass

מיין לפי

		1. Increased beta-globin production
		2. Incorrect splicing of the RNA product
		3. Production of an unstable beta-globin protein
		4. Synthesis of a non-functional gene product.
		5. No effect

		1. NH2-Ser-Gln-Pro
		2. NH2-Gly-Trp-Gly
		3. NH2-Ala-Gly-Ala
		4. NH2-Ala-Gly-Trp
		5. NH2-Trp-Gly-Ala

		1. 5'-CAU-3'
		2. 5'-UAC-3'
		3. 5'-GUA-3'
		4. 5'-AUG-3'
		4. 5'-AUG-3'

		1. Specification of amino acids.
		2. Binding to complementary sequences in mRNAs
		3. Identification of the start of genes encoding mRNAs.
		4. Marking the start of translation
		5. Marking the boundary between adjacent coding regions on mRNAs

		1. The same RNA sequence being read by one ribosome may produce a different amino acid sequence when read by another
		2. Bacteria and eukaryotes use different codons for the same amino acid
		3. Some amino acids have more than one corresponding tRNA
		4. Several different amino acids may be specified by the same codon.
		5. A translational proofreading mechanism is implemented to fix the errors caused by the degeneracy.

Molecular Biology Module 4: Translation

Discuss, Learn and be Happy דיון בשאלות

שאלה #57530

(USMLoid) Which of the following tripeptides would be represented in polypeptides produced following the addition of the sequence (5'-GGCU)50 to a cell-free translation system?

שאלה #57531

An anticodon of human tyrosinyl-tRNA is 5'-GUA-3'. Which of the following is most likely to be a tyrosine codon?

שאלה #57532

(USMLoid) Which of the following best describes the role of codons in eukaryotic cells?

שאלה #57550

(USMLoid) Which of the following is a result of the degeneracy of the genetic code?.

שאלה #57551

(USMLoid) Which of the following is responsible for determining the amino acid sequence of a protein being synthesized by a ribosome.

שאלה #57552

(USMLoid) The single tyrosine tRNA recognises both of the tyrosine codons - UAU and UAC. Which of the following is therefore the anticodon sequence of this tRNA?

שאלה #57553

The following piece of DNA codes for an mRNA. The top strand is the template strand. The initiation and termination codons are in the sequence. 5'-AATTACCATGAAATTGTCATCTACTTGTTGATTA-3' 3'-TTAATGGTACTTTAACAGTAGATGAACAACTAAT-5 The sequence of the protein encoded by this transcript is:

שאלה #57554

שאלה #57555

Acetylation of histones often results in:

שאלה #57559

		1. Elongation factor G
		2. Ribosomal RNA
		4. aminoacyl tRNA
		5. mRNA

Molecular Biology Module 4: Translation

Discuss, Learn and be Happy דיון בשאלות

(USMLoid) Which of the following tripeptides would be represented in polypeptides produced following the addition of the sequence (5'-GGCU)50 to a cell-free translation system?

An anticodon of human tyrosinyl-tRNA is 5'-GUA-3'. Which of the following is most likely to be a tyrosine codon?

(USMLoid) Which of the following best describes the role of codons in eukaryotic cells?

(USMLoid) Which of the following is a result of the degeneracy of the genetic code?.

(USMLoid) Which of the following is responsible for determining the amino acid sequence of a protein being synthesized by a ribosome.

(USMLoid) The single tyrosine tRNA recognises both of the tyrosine codons - UAU and UAC. Which of the following is therefore the anticodon sequence of this tRNA?

The following piece of DNA codes for an mRNA. The top strand is the template strand. The initiation and termination codons are in the sequence. 5'-AATTACCATGAAATTGTCATCTACTTGTTGATTA-3' 3'-TTAATGGTACTTTAACAGTAGATGAACAACTAAT-5 The sequence of the protein encoded by this transcript is:

Acetylation of histones often results in:

בקשה לשינוי התשובה / תיקון שאלה gavel

בקשה למחיקת השאלהmood_bad

בקשה לשינוי התשובה / תיקון שאלה

בקשה למחיקת השאלה